BLASTN 2.0.14 [Jun-29-2000]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

RID: 965582664-19604-1906

Query= (70 letters)

Database: nt 651,732 sequences; 2,161,632,008 total letters

If you have any problems or questions with the results of this search
please refer to the BLAST FAQs

Taxonomy reports

Distribution of 10 Blast Hits on the Query Sequence


                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gb|L22754.1|HUMBGLOBC  Human beta-globin cluster gene, enhan...   139  1e-31
gb|U01317.1|HUMHBB  Human beta globin region on chromosome 11     139  1e-31
gb|AC008068.4|AC008068  Homo sapiens clone RP11-334F17, comp...    36  1.4
gb|AE001095.1|AE001095  Archaeoglobus fulgidus section 12 of...    36  1.4
emb|AL035588.21|HS696P19  Human DNA sequence from clone 696P...    36  1.4
gb|AC004554.1|AC004554  Homo sapiens Xp22 BAC GSHB-590J6 (Ge...    34  5.6
gb|AC006456.2|AC006456  Homo sapiens PAC clone RP5-969D4 fro...    34  5.6
gb|AF178573.1|AF178573  White spot syndrome virus of penaeid...    34  5.6
gb|AC007628.3|AC007628  Genomic sequence of Homo sapiens clo...    34  5.6
emb|AL121873.15|HSB362E11  Human DNA sequence from clone RP1...    34  5.6

Alignments
>gb|L22754.1|HUMBGLOBC Human beta-globin cluster gene, enhancers with repeat region
          Length = 2999

 Score =  139 bits (70), Expect = 1e-31
 Identities = 70/70 (100%)
 Strand = Plus / Plus

                                                                        
Query: 1    gaattctaatctccctctcaaccctacagtcacccatttggtatattaaagatgtgttgt 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2688 gaattctaatctccctctcaaccctacagtcacccatttggtatattaaagatgtgttgt 2747

                      
Query: 61   ctactgtcta 70
            ||||||||||
Sbjct: 2748 ctactgtcta 2757
>gb|U01317.1|HUMHBB Human beta globin region on chromosome 11
          Length = 73308

 Score =  139 bits (70), Expect = 1e-31
 Identities = 70/70 (100%)
 Strand = Plus / Plus

                                                                      
Query: 1  gaattctaatctccctctcaaccctacagtcacccatttggtatattaaagatgtgttgt 60
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1  gaattctaatctccctctcaaccctacagtcacccatttggtatattaaagatgtgttgt 60

                    
Query: 61 ctactgtcta 70
          ||||||||||
Sbjct: 61 ctactgtcta 70
>gb|AC008068.4|AC008068 Homo sapiens clone RP11-334F17, complete sequence
          Length = 154036

 Score = 36.2 bits (18), Expect = 1.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 45    attaaagatgtgttgtct 62
             ||||||||||||||||||
Sbjct: 49740 attaaagatgtgttgtct 49723
>gb|AE001095.1|AE001095 Archaeoglobus fulgidus section 12 of 172 of the complete genome
          Length = 10592

 Score = 36.2 bits (18), Expect = 1.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 6    ctaatctccctctcaacc 23
            ||||||||||||||||||
Sbjct: 6234 ctaatctccctctcaacc 6217
>emb|AL035588.21|HS696P19 Human DNA sequence from clone 696P19 on chromosome 6p12.3-21.2.
             Contains the gene for TFEB, an NPM1 (Nucleophosmin,
             Numatrin) pseudogene and the MDFI gene for MyoD family
             inhibitor (myogenic repressor I-MF). Contains ESTs, STSs,
             GSSs and two putative C>
          Length = 110665

 Score = 36.2 bits (18), Expect = 1.4
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 33    cccatttggtatattaaa 50
             ||||||||||||||||||
Sbjct: 95717 cccatttggtatattaaa 95700
>gb|AC004554.1|AC004554 Homo sapiens Xp22 BAC GSHB-590J6 (Genome Systems Human BAC library)
             complete sequence
          Length = 195142

 Score = 34.2 bits (17), Expect = 5.6
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                              
Query: 37    tttggtatattaaagat 53
             |||||||||||||||||
Sbjct: 95915 tttggtatattaaagat 95931
>gb|AC006456.2|AC006456 Homo sapiens PAC clone RP5-969D4 from 7q33-q35, complete sequence
          Length = 75609

 Score = 34.2 bits (17), Expect = 5.6
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                  
Query: 25    tacagtcacccatttggtata 45
             ||||||||| |||||||||||
Sbjct: 63943 tacagtcactcatttggtata 63963
>gb|AF178573.1|AF178573 White spot syndrome virus of penaeid shrimp, genomic sequence
          Length = 2833

 Score = 34.2 bits (17), Expect = 5.6
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                 
Query: 39   tggtatattaaagatgtgttg 59
            |||||||||||| ||||||||
Sbjct: 1396 tggtatattaaatatgtgttg 1416
>gb|AC007628.3|AC007628 Genomic sequence of Homo sapiens clone N0576M10 from chromosome 18,
             complete sequence
          Length = 140356

 Score = 34.2 bits (17), Expect = 5.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 2     aattctaatctccctct 18
             |||||||||||||||||
Sbjct: 81447 aattctaatctccctct 81431
>emb|AL121873.15|HSB362E11 Human DNA sequence from clone RP13-362E11 on chromosome X. Contains a
             pseudogene similar to mouse GEG-154 and mosquito MRRG, a
             pseudogene similar to human MMS2 and chicken CROC-1B,
             ESTs, STSs and GSSs, complete sequence [Homo sapiens]
          Length = 212280

 Score = 34.2 bits (17), Expect = 5.6
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                              
Query: 37    tttggtatattaaagat 53
             |||||||||||||||||
Sbjct: 63628 tttggtatattaaagat 63612
  Database: nt
    Posted date:  Aug 5, 2000  9:23 PM
  Number of letters in database: -2,133,335,288
  Number of sequences in database:  651,732
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 71169
Number of Sequences: 651732
Number of extensions: 71169
Number of successful extensions: 16960
Number of sequences better than 10.0: 16
length of query: 70
length of database: 2,161,632,008
effective HSP length: 19
effective length of query: 51
effective length of database: 2,149,249,100
effective search space: 109611704100
effective search space used: 109611704100
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 10 (19.8 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)