COMPUTER LABORATORY EXERCISES

· Exercise 1: A Basic blastn search

· Exercise 2: A Basic blastn search with a query containing a repetitive sequence

· Exercise 3: A Basic blastx search with a query containing a repetitive sequence

· Exercise 4: A Basic blastn search (Part I: query length and expectation value)

· Exercise 5: A Basic blastn search (Part II: query length and expectation value)

· Exercise 6: An Advanced blastn search (Part III: query length and expectation value)

· Exercise 7: A FASTA search

· Exercise 8: A FASTX search

· Exercise 9: Swiss-Prot Protein Database Searching

· Exercise 10: Nucleotide Sequence Translation

· Exercise 11: A blastp Search

· Exercise 12: A PROSITE Search

· Exercise 13: Finding Restriction Enzyme Sites

· Exercise 14: Modular Domains

Exercise 1: A Basic blastn search

1. Copy the sequence below:

AAAAGAAAAGGTTAGAAAGATGAGAGATGATAAAGGGTCCATTTGAGGTTAGGTAA

2. Access the NCBI BLAST search website and paste the query sequence in the space provided.

3. Select: Program Þ blastn Database Þ nr (nonredundant)

4. If you want to conduct an online search, please include your email address and click Search.

5. Search output.

Exercise 2: A Basic blastn search with a query containing a repetitive sequence

1. Copy the sequence below:

GTCCGGCCTGGGCGACAGAGCAAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

2. Access the NCBI BLAST search website and paste the query sequence in the space provided.

3. Select: Program Þ blastn Database Þ nr (nonredundant)

4. If you want to conduct an online search, please include your email address and click Search.

5. Search output.

Exercise 3: A blastx search with a query containing a repetitive sequence

1. Copy the sequence below (NOTE: same query as for Exercise 2):

GTCCGGCCTGGGCGACAGAGCAAGACTCCGTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

2. Access the NCBI BLAST search website and paste the query sequence in the space provided.

3. Select: Program Þ blastx Database Þ SwissProt

4. If you want to conduct an online search, please include your email address and click Search.

5. Search output.

Exercise 4: A Basic blastn search (Part I: query length and expectation value)

1. Copy the sequence below:

GAATTCTAATCTCCCTCTCAACCCTACAGTCACCCATTTGGTATATTAAAGATGTGTTGTCTACTGTCTA

2. Access the NCBI BLAST search website and paste the query sequence in the space provided.

3. Select: Program Þ blastn Database Þ nr (nonredundant)

4. If you want to conduct an online search, please include your email address and click Search.

5. Search output.

Exercise 5: A Basic blastn search (Part II: query length and expectation value)

1. Copy the sequence below (12 bases of the 5’-terminus):

GAATTCTAATCT

2. Access the NCBI BLAST search website and paste the query sequence in the space provided.

3. Select: Program Þ blastn Database Þ nr (nonredundant)

4. If you want to conduct an online search, please include your email address and click Search.

5. Search output.

Exercise 6: An Advanced blastn search (Part III: query length and expectation value)

1. Copy the sequence below (Same sequence as Exercise 5):

GAATTCTAATCT

2. Access the NCBI BLAST search website and paste the query sequence in the space provided.

3. Select: Program Þ blastn Database Þ EMBL Select E-value of 1000

4. If you want to conduct an online search, please include your email address and click Search.

5. Search output.

Exercise 7: A FASTA search

1. Copy the sequence below:

GAATTCTAATCTCCCTCTCAACCC

2. Access the FASTA search website and paste the query sequence in the space provided.

3. Select: Program Þ FASTA3 Database Þ HUMAN NUCLEIC ACID KTUP = 1

4. If you want to conduct an online search, please include your email address and click Search.

5. Search output.

Exercise 8: A FASTX search

1. Copy the sequence below:

CCAGATCCTGGACAGAGGACAATGGCTTCCATGCAATTGGGCAGATGTGTGAGGCACCTGTGGTGACC

2. Access the FASTA search website and paste the query sequence in the space provided.

3. Select: Program Þ FASTX Database Þ SwissProt MATRIX = BLOSUM50 KTUP = 2

4. If you want to conduct an online search, please include your email address and click Search.

5. Search output.

Exercise 9: Swiss-Prot Protein Database Searching

1. Access the Swiss-Prot Protein search website.

2. Enter P00439 for the accession number

3. Scroll the output page and go to the Protein Data Bank (PDB)

4. Select PDB code 6PAH Þ RCSB to visualize protein structure

Exercise 10: Nucleotide Sequence Translation

1. Copy the sequence below:

1 atggcgactg cgacccccgt gccgccgcgg atgggcagcc gcgctggcgg ccccaccacg 61 ccgctgagcc ccacgcgcct gtcgcggctc caggagaagg aggagctgcg cgagctcaat 121 gaccggctgg cggtgtacat cgacaaggtg cgcagcctgg agacggagaa cagcgcgctg 181 cagctgcagg tgacggagcg cgaggaggtg cgcggccgtg agctcaccgg cctcaaggcg

2. Access the Translation Machine at EBI and paste the query sequence in the space provided

3. Select standard translation table, Frame: 1 and Complement: No

4. Activate translation and copy output protein sequence

Exercise 11: Blastp Search

1. Access the ExPAsy Server

2. Paste sequence copied from previous exercise

3. Activate search

Exercise 12: PROSITE Search

1. Access PROSITE search site

2. Paste sequence copied from previous exercise

3. Search for motifs

Exercise 13: Finding Restriction Enzyme Sites

1. Copy nucleotide sequence (Exercise 10)

2. Access the WebCutter Site

3. Paste sequence and select defaults

4. Activate analysis

Exercise 14: Modular Domains

1. Access NCBI and request accession number AB035301

2. Access SMART and enter AB035301

3. Press “Display all proteins with similar domain composition”

4. Go back to the modular illustration and click on one of the CA domains

5. Click on “Evolution” for links to PDB 3-D structures